Sequence retrieval

Genome: Burkholderia xenovorans LB400 chromosome 1
Start position: 1143889
End position: 1143912
Length: 24

DNA sequence
>NC_007951, from 1143889 to 1143912 (24 bp); Burkholderia xenovorans LB400 chromosome 1 CGGCATTGGCATTGGCATTGGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1143852-1144388	Sequence	Bxe_A3429 - hypothetical protein (Protein is coded in complementary strand; from 1144388 to 1143852)