Sequence retrieval

Genome: Jannaschia sp. CCS1
Start position: 4154692
End position: 4154715
Length: 24

DNA sequence
>NC_007802, from 4154692 to 4154715 (24 bp); Jannaschia sp. CCS1 GGATGCGGACGCGGATGGGGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4154340-4155503	Sequence	Jann_4050 - acetyl-CoA C-acetyltransferase (Protein is coded in complementary strand; from 4155503 to 4154340)