Sequence retrieval

Genome: Jannaschia sp. CCS1
Start position: 4029456
End position: 4029488
Length: 33

DNA sequence
>NC_007802, from 4029456 to 4029488 (33 bp); Jannaschia sp. CCS1 TACGGAAAAACTACAGGAAAACTACGGATAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4029489-4030604	Sequence	Jann_3932 - ABC transporter-like protein (Protein is coded in complementary strand; from 4030604 to 4029489)