Sequence retrieval

Genome: Jannaschia sp. CCS1
Start position: 3884145
End position: 3884168
Length: 24

DNA sequence
>NC_007802, from 3884145 to 3884168 (24 bp); Jannaschia sp. CCS1 CGCCAGCGGCAGGGCCAGCGCAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3882406-3884331	Sequence	Jann_3796 - TRAP transporter, 4TM/12TM fusion protein (Protein is coded in complementary strand; from 3884331 to 3882406)