Sequence retrieval

Genome: Jannaschia sp. CCS1
Start position: 370242
End position: 370266
Length: 25

DNA sequence
>NC_007802, from 370242 to 370266 (25 bp); Jannaschia sp. CCS1 CGGGGCGGTGCGGGCCGTGGCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 370189-370539	Sequence	Jann_0367 - hypothetical protein (Protein is coded in complementary strand; from 370539 to 370189)