Sequence retrieval

Genome: Jannaschia sp. CCS1
Start position: 3548941
End position: 3548965
Length: 25

DNA sequence
>NC_007802, from 3548941 to 3548965 (25 bp); Jannaschia sp. CCS1 GCAGCGCAGGGCAGAACAGCGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3547922-3551329	Sequence	Jann_3494 - bifunctional proline dehydrogenase/pyrroline-5-carboxylate dehydrogenase (Protein is coded in complementary strand; from 3551329 to 3547922)