Sequence retrieval

Genome: Jannaschia sp. CCS1
Start position: 3527770
End position: 3527805
Length: 36

DNA sequence
>NC_007802, from 3527770 to 3527805 (36 bp); Jannaschia sp. CCS1 GTGTCATTCCCCGCGTCATTCCCTGTGCCATCCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3527328-3527777	Sequence	Jann_3475 - hypothetical protein (Protein is coded in complementary strand; from 3527777 to 3527328)
ORF. 3527746-3528054	Sequence	Jann_3476 - hypothetical protein (Protein is coded in complementary strand; from 3528054 to 3527746)