Sequence retrieval

Genome: Jannaschia sp. CCS1
Start position: 2533582
End position: 2533611
Length: 30

DNA sequence
>NC_007802, from 2533582 to 2533611 (30 bp); Jannaschia sp. CCS1 CGGCCTCGGCCACGACCTCGGCATCGTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2532747-2533874	Sequence	Jann_2533 prfB peptide chain release factor 2 (Protein is coded in complementary strand; from 2533874 to 2532747)