Sequence retrieval

Genome: Jannaschia sp. CCS1
Start position: 1876183
End position: 1876206
Length: 24

DNA sequence
>NC_007802, from 1876183 to 1876206 (24 bp); Jannaschia sp. CCS1 GCCGCCGCCCCCTCCGCCGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1876031-1876561	Sequence	Jann_1885 - single-strand binding protein (Protein is coded in complementary strand; from 1876561 to 1876031)