Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus USA300_FPR3757
Start position: 881383
End position: 881406
Length: 24

DNA sequence
>NC_007793, from 881383 to 881406 (24 bp); Staphylococcus aureus subsp. aureus USA300_FPR3757 AAAAGTATAAAAGTTTAAAAGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 881032-881853	Sequence	SAUSA300_0798 - ABC transporter substrate-binding protein