Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus USA300_FPR3757
Start position: 459718
End position: 459741
Length: 24

DNA sequence
>NC_007793, from 459718 to 459741 (24 bp); Staphylococcus aureus subsp. aureus USA300_FPR3757 GGAAAATAGCAAAATAGAAAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 459045-460256	Sequence	SAUSA300_0406 - putative restriction/modification system specificity protein