Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus USA300_FPR3757
Start position: 2775126
End position: 2775179
Length: 54

DNA sequence
>NC_007793, from 2775126 to 2775179 (54 bp); Staphylococcus aureus subsp. aureus USA300_FPR3757 GAATCGCTATCTGAATCTGAATCGCTATCTGAATCTGAATCGCTATCTGAATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2774340-2777039	Sequence	SAUSA300_2565 clfB clumping factor B (Protein is coded in complementary strand; from 2777039 to 2774340)