Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus USA300_FPR3757
Start position: 2489975
End position: 2490019
Length: 45

DNA sequence
>NC_007793, from 2489975 to 2490019 (45 bp); Staphylococcus aureus subsp. aureus USA300_FPR3757 TTATTATTCGCTTGGTTATTACTTGATTGGTTATTATTTGTTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2489654-2490283	Sequence	SAUSA300_2315 - hypothetical protein (Protein is coded in complementary strand; from 2490283 to 2489654)