Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus USA300_FPR3757
Start position: 2314534
End position: 2314563
Length: 30

DNA sequence
>NC_007793, from 2314534 to 2314563 (30 bp); Staphylococcus aureus subsp. aureus USA300_FPR3757 CATGTATCTTGATGCATCTTCAGGTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2313926-2315119	Sequence	SAUSA300_2139 - putative transporter (Protein is coded in complementary strand; from 2315119 to 2313926)