Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus USA300_FPR3757
Start position: 2143464
End position: 2143487
Length: 24

DNA sequence
>NC_007793, from 2143464 to 2143487 (24 bp); Staphylococcus aureus subsp. aureus USA300_FPR3757 TTTGGATTCGGATTTGGCTTTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2142753-2144006	Sequence	SAUSA300_1985 sdrH serine-aspartate repeat-containing protein SdrH (Protein is coded in complementary strand; from 2144006 to 2142753)