Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus USA300_FPR3757
Start position: 2115106
End position: 2115138
Length: 33

DNA sequence
>NC_007793, from 2115106 to 2115138 (33 bp); Staphylococcus aureus subsp. aureus USA300_FPR3757 GTGTTGGTTTGATGTTGTTTTGATGTTGGGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2114638-2115531	Sequence	SAUSA300_1957 - phiPVL ORF046-like protein (Protein is coded in complementary strand; from 2115531 to 2114638)