Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus USA300_FPR3757
Start position: 1917175
End position: 1917199
Length: 25

DNA sequence
>NC_007793, from 1917175 to 1917199 (25 bp); Staphylococcus aureus subsp. aureus USA300_FPR3757 TTTTTTCTTTCTTTTTTTATTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1917170-1917571	Sequence	SAUSA300_1732 - putative transposase (Protein is coded in complementary strand; from 1917571 to 1917170)