Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus USA300_FPR3757
Start position: 1544557
End position: 1544586
Length: 30

DNA sequence
>NC_007793, from 1544557 to 1544586 (30 bp); Staphylococcus aureus subsp. aureus USA300_FPR3757 TTTTGTTTCTGTATTTGTTTCTGTATTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1543733-1544611	Sequence	SAUSA300_1378 - hypothetical protein (Protein is coded in complementary strand; from 1544611 to 1543733)