Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus USA300_FPR3757
Start position: 1123978
End position: 1124004
Length: 27

DNA sequence
>NC_007793, from 1123978 to 1124004 (27 bp); Staphylococcus aureus subsp. aureus USA300_FPR3757 CTTTAACTTCTTTAACTTCTTTAGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1122351-1124288	Sequence	SAUSA300_1028 - iron transport associated domain-containing protein (Protein is coded in complementary strand; from 1124288 to 1122351)