Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus USA300_FPR3757
Start position: 1039593
End position: 1039619
Length: 27

DNA sequence
>NC_007793, from 1039593 to 1039619 (27 bp); Staphylococcus aureus subsp. aureus USA300_FPR3757 TCAGGGTTGTTAGGGTTGTCAGGGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1039542-1040552	Sequence	SAUSA300_0951 sspA V8 protease (Protein is coded in complementary strand; from 1040552 to 1039542)