Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 958668
End position: 958691
Length: 24

DNA sequence
>NC_007705, from 958668 to 958691 (24 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 CCGTGGCACCGTGGCACCGTGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 957608-958693	Sequence	XOO_0874 - H+ translocating pyrophosphate synthase (Protein is coded in complementary strand; from 958693 to 957608)