Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 825551
End position: 825574
Length: 24

DNA sequence
>NC_007705, from 825551 to 825574 (24 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 CTTCCGCCCTTTCGCCGTTCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 825533-829585	Sequence	XOO_0766 - phosphoribosylformylglycinamidine synthase