Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 698121
End position: 698156
Length: 36

DNA sequence
>NC_007705, from 698121 to 698156 (36 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 GGCCAGCCACAAGCCCAGCCACAAGCCCAGCCACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 697636-698487	Sequence	XOO_0645 - hypothetical protein (Protein is coded in complementary strand; from 698487 to 697636)