Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 566321
End position: 566348
Length: 28

DNA sequence
>NC_007705, from 566321 to 566348 (28 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 TGGGATTGGGGATTCGGGATTGGGGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 564955-566322	Sequence	XOO_0520 - acetyl-CoA carboxylase biotin carboxylase subunit (Protein is coded in complementary strand; from 566322 to 564955)