Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 4741363
End position: 4741386
Length: 24

DNA sequence
>NC_007705, from 4741363 to 4741386 (24 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 TCTGCATCTGCTGCTGCATCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4741173-4742036	Sequence	XOO_4196 - hypothetical protein (Protein is coded in complementary strand; from 4742036 to 4741173)