Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 4622784
End position: 4622807
Length: 24

DNA sequence
>NC_007705, from 4622784 to 4622807 (24 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 GCGTCGGCGCCGGCGCCGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4621575-4622942	Sequence	XOO_4098 - MFS transporter (Protein is coded in complementary strand; from 4622942 to 4621575)