Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 4536536
End position: 4536571
Length: 36

DNA sequence
>NC_007705, from 4536536 to 4536571 (36 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 GCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4535966-4536712	Sequence	XOO_4022 - hypothetical protein (Protein is coded in complementary strand; from 4536712 to 4535966)