Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 4406765
End position: 4406788
Length: 24

DNA sequence
>NC_007705, from 4406765 to 4406788 (24 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 TGTCGCGCGGTCGCGCGGTCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4406753-4408069	Sequence	XOO_3908 - ISXo8 transposase (Protein is coded in complementary strand; from 4408069 to 4406753)