Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 4345940
End position: 4345963
Length: 24

DNA sequence
>NC_007705, from 4345940 to 4345963 (24 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 GCTGCAGCCGCAGCGGCAGCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4344595-4346145	Sequence	XOO_3840 - monovalent cation/H+ antiporter subunit D