Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 4119069
End position: 4119116
Length: 48

DNA sequence
>NC_007705, from 4119069 to 4119116 (48 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 CGGCGGTCGTCACGGCGGTCGTCACGGCGGTCGTCACGGCGGTCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4118748-4119281	Sequence	XOO_3641 - hypothetical protein (Protein is coded in complementary strand; from 4119281 to 4118748)