Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 4117896
End position: 4117940
Length: 45

DNA sequence
>NC_007705, from 4117896 to 4117940 (45 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 GTTGGAATTGGTGGTGTTGGAGGTCGTGGTGTTGGAGGTCGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4115722-4118076	Sequence	XOO_3640 - TonB-dependent receptor (Protein is coded in complementary strand; from 4118076 to 4115722)