Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 3890783
End position: 3890806
Length: 24

DNA sequence
>NC_007705, from 3890783 to 3890806 (24 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 GCCGACCCCGACCCCGACCCCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3890355-3891032	Sequence	XOO_3432 - RNA polymerase factor sigma-70