Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 375244
End position: 375267
Length: 24

DNA sequence
>NC_007705, from 375244 to 375267 (24 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 ATGACCATGACCATGACCATGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 374786-375787	Sequence	XOO_0345 - heavy metal transporter (Protein is coded in complementary strand; from 375787 to 374786)