Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 3633541
End position: 3633564
Length: 24

DNA sequence
>NC_007705, from 3633541 to 3633564 (24 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 CACCAGCATCAGCACCACCGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3633176-3633682	Sequence	XOO_3204 - hypothetical protein (Protein is coded in complementary strand; from 3633682 to 3633176)