Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 3623726
End position: 3623753
Length: 28

DNA sequence
>NC_007705, from 3623726 to 3623753 (28 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 CGAATCCCGAATGCCGACTCCCGAATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3621786-3623762	Sequence	XOO_3197 - bifunctional sulfate adenylyltransferase subunit 1/adenylylsulfate kinase (Protein is coded in complementary strand; from 3623762 to 3621786)