Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 3564615
End position: 3564638
Length: 24

DNA sequence
>NC_007705, from 3564615 to 3564638 (24 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 GGCGCTGGCCCTGGCCCTTGCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3563261-3565903	Sequence	XOO_3142 leuS leucyl-tRNA synthetase (Protein is coded in complementary strand; from 3565903 to 3563261)