Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 2938625
End position: 2938684
Length: 60

DNA sequence
>NC_007705, from 2938625 to 2938684 (60 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 GGTCCAGCCGGCCGGGATCCAGCCGGCCGGGGTCCAGCCGGCCGGGGTCCAGCCGGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2937702-2939426	Sequence	XOO_2632 - integral membrane transporter (Protein is coded in complementary strand; from 2939426 to 2937702)