Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 2157033
End position: 2157060
Length: 28

DNA sequence
>NC_007705, from 2157033 to 2157060 (28 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 GAATGGGGAATGGAGAATCGGGAATGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2156421-2159174	Sequence	XOO_1954 - 5-methyltetrahydrofolate--homocysteine methyltransferase (Protein is coded in complementary strand; from 2159174 to 2156421)