Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 2143374
End position: 2143397
Length: 24

DNA sequence
>NC_007705, from 2143374 to 2143397 (24 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 GCTGCGGCTGCGGCTGCGGCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2142609-2143445	Sequence	XOO_1940 - hypothetical protein (Protein is coded in complementary strand; from 2143445 to 2142609)