Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 2044446
End position: 2044473
Length: 28

DNA sequence
>NC_007705, from 2044446 to 2044473 (28 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 CGGGATTCGGCATTCGGGATTGGGGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2043807-2044547	Sequence	XOO_1853 rnhB ribonuclease HII (Protein is coded in complementary strand; from 2044547 to 2043807)