Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 2040303
End position: 2040326
Length: 24

DNA sequence
>NC_007705, from 2040303 to 2040326 (24 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 CGCCGCCGCCCCCACCGCCGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2039759-2043349	Sequence	XOO_1852 dnaE DNA polymerase III subunit alpha (Protein is coded in complementary strand; from 2043349 to 2039759)