Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 2006437
End position: 2006464
Length: 28

DNA sequence
>NC_007705, from 2006437 to 2006464 (28 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 GGGATTGGAGATTGGGGATTGGGGATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2006105-2008189	Sequence	XOO_1823 metG methionyl-tRNA synthetase (Protein is coded in complementary strand; from 2008189 to 2006105)