Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 2001151
End position: 2001175
Length: 25

DNA sequence
>NC_007705, from 2001151 to 2001175 (25 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 TGCAGTGCAATGAAGGGCAGTGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2000341-2001339	Sequence	XOO_1815 - delta 9 acyl-lipid fatty acid desaturase (Protein is coded in complementary strand; from 2001339 to 2000341)