Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 1258369
End position: 1258404
Length: 36

DNA sequence
>NC_007705, from 1258369 to 1258404 (36 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 AGCTACACGCCAAGCTACACGCCAAGCTACACGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1258187-1259095	Sequence	XOO_1154 - hypothetical protein (Protein is coded in complementary strand; from 1259095 to 1258187)