Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 1220025
End position: 1220052
Length: 28

DNA sequence
>NC_007705, from 1220025 to 1220052 (28 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 CGCCGCGCGCCGCATGCCGCGCGCCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1218410-1220068	Sequence	XOO_1126 - transcriptional regulator (Protein is coded in complementary strand; from 1220068 to 1218410)
ORF. 1219815-1221215	Sequence	XOO_1127 - transcriptional regulator (Protein is coded in complementary strand; from 1221215 to 1219815)