Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 3650764
End position: 3650808
Length: 45

DNA sequence
>NC_007705, from 3650764 to 3650808 (45 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 AGGTTGCGGTTGCGCTGGTTGCGGTTGCGCTGGTTGCGGTTGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3648386-3651226	Sequence	XOO_3217 - hypothetical protein (Protein is coded in complementary strand; from 3651226 to 3648386)