Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 569053
End position: 569076
Length: 24

DNA sequence
>NC_007705, from 569053 to 569076 (24 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 GCACCAGCGCCAGCACCAGCATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 568662-570986	Sequence	XOO_0524 - C-type cytochrome biogenesis protein (Protein is coded in complementary strand; from 570986 to 568662)