Sequence retrieval

Genome: Xanthomonas oryzae pv. oryzae MAFF 311018
Start position: 3889677
End position: 3889700
Length: 24

DNA sequence
>NC_007705, from 3889677 to 3889700 (24 bp); Xanthomonas oryzae pv. oryzae MAFF 311018 CACCGCCACCGCCACCGCCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3888538-3890031	Sequence	XOO_3430 - pyridine nucleotide transhydrogenase subunit beta (Protein is coded in complementary strand; from 3890031 to 3888538)