Sequence retrieval

Genome: Shigella boydii Sb227
Start position: 996973
End position: 997008
Length: 36

DNA sequence
>NC_007613, from 996973 to 997008 (36 bp); Shigella boydii Sb227 TTCTTGATCTGTATCTTTATCTGTATCTTTATCTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 996374-997444	Sequence	SBO_0971 - hypothetical protein (Protein is coded in complementary strand; from 997444 to 996374)