Sequence retrieval

Genome: Shigella boydii Sb227
Start position: 4361431
End position: 4361466
Length: 36

DNA sequence
>NC_007613, from 4361431 to 4361466 (36 bp); Shigella boydii Sb227 CATGCCGCCCATGCCACCCATGCCGCCCATACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4361426-4363072	Sequence	SBO_4313 groEL chaperonin GroEL (Protein is coded in complementary strand; from 4363072 to 4361426)